Thursday, June 9, 2016

PROJECT 6. Repair Template Verification (NK).


Project 6. Following Gibson Assembly. Verification of the Repair Template Construction by Restriction Enzyme Digestion and Gel Electrophoresis (Isolates: NK44-1 through 4). 


Figure Legend. The ClaI enzyme was chosen because it cuts experimental and control in different ways. When pDD286 is digested with ClaI, we should see 2 bands (not shown). By contrast, when the desired repair template is digested, we should see 1 band that is 10kb in size. On the gel image above, we can see that a Cla I digest of isolates NK44-2, -3 and -4 produce a single 10kb band as expected suggesting that Gibson Aseembly worked for these isolates. 


Tuesday, June 7, 2016

PROJECT 2. Repair Template Verification





























  • Project 2: unc-11, N terminal fusion, long isoform. Restriction enzyme done by NgoMIV. 
  • It was expected that after Gibson assembly there will be no cut and one bright band is expected on the gel. 
  • The control has worked very well and this is what we expected to see in our samples. Band size of control lower- 3241 bp and top band is 7263 bp as compared to 1 kb ladder. 

Wednesday, May 11, 2016

PROJECTS 3 and 5. Homology Arm Amplification

Lane code
Amplification
Amplicon size
Project
ND 22_1
ND 22_2
5’ Homology arm amplification
746 bp
Project 3
Sax-2_N_S
ND 22_3
ND 22_4
3’ Homology arm amplification
741 bp
DP_315’F
DP_315’R
5’ Homology arm amplification
No result
Project 5
Unc-11_C_S
DP_313’F
DP_315’F
3’ Homology arm amplification
No result
AH 21_1
AH 21_2
5’ Homology arm amplification
721 bp
AH 21_3
AH 21_4
3’ Homology arm amplification
795 bp

1.5% Agarose gel was used.

PROJECT 2. Homology Arm Amplification

                     

                 Homology arm Result for Project 2 (Gel image 2 after 10 mins extra run time)

In this step of project 2 (N-terminal knock-in of unc-11 long isoform), we amplified our homology arms from C.elegans genomic DNA. 

Lane 1 and 2: 5' homology arm (ISOLATE CODES?)
Lane 3 and 4: 3' homology arm (ISOLATE CODES?)
Lane 5: 1kb ladder from NEB
Lane 6 and 7: 5' homology arm (ISOLATE CODES?)
Lane 8 and 9: 3' homology arm (ISOLATE CODES?)

The predicted sizes of each arm are 699bp for 5' and 605bp for 3'. Pairs of primers used:
5' Homology- Forward primer:TGTAAAACGACGGCCAGTCGGGCAAATCCCTGCGGAAATGAGA
5' Homology- Reverse primer: TCCTCTCCCTTGGAGACCATgtcgagcagcaaggggggt
3' Homology- Forward primer: TGATCAGCGAGGAAGACTTGATGcagactatcgagaaagc
3' Homology- Reverse primer: AACAGCTATGACCATGTTATtcgagagctaatttcagcga

Comparing the sizes of the bands with 1kb ladder, the bands run from 600pb to 700bp as what expected.

5' homolgy arm result for Project 2


Thursday, April 28, 2016




Nidhi: Creating an N-terminal fusion of sax-2 gene short isoform.
a)    Created the sgRNA::CAS9 construct (pJW1219, 8168bp) containing the gRNA corresponding to sax-2 gene short isoform via SDM.
b)    RE digestion of repair template (pDD282_GFP_isolate 3, 10475bp) with AvrII and SpeI.

---------------------------

Debjani: Creating a C-terminal fusion of unc-11 gene knock in.
               Forward primer : cgactagaCTAtaatccaaaGTTTAAGAGCTATGCTGGAA
                 Reverse Primer  : CAAGACATCTCGCAATAGGA
    Purpose : For SDM to create the Cas9-sgRNA construct (pJW1219) to include the  guide RNA   (no PAM) corresponding to unc-11 knock in.

                 Restriction enzyme digestion of repair template (pDD286_RFP_Knock in ) with AvrII and NgoMIV.

---------------------------------

Leena: Ran a 1% agarose gel with 2-log DNA ladder(0.1-1kb)
Creating a C-terminal fusion for sax-2 gene, using NEB Q5 Site-Directed Mutagenesis. We are using Cas9-sgRNA construct (pJW1219-10, 8168bp) containing target sequence(gRNA) to knock-in target sequence of 20 nucleotides. Simultaneously creating a repair template by doing restriction digestion of ccdb in pDD286-6 using AvrII and NgoMIV.

Verifying the following:
1.RE digestion of repair template(pDD286-6) removing ccdb using AvrII and NgoMIV - 5ul sample was loaded
MLP-RE
DNA: pDD286-6 (10504 bp), 221.0ng/ul-  4.5ul
R.Enzymes:
AvrII,5U/ul –  2ul
NgoMIV,10U/ul- 1ul
RE digest products: 6654 bp, 2638 bp, (609 bp,603 bp – as one band)

2. PCR amplification of sgRNA::CAS9 construct (pJW1219-10, 8168bp) containing the target sequence, knock in - C-terminal fusion using SDM. - 4ul sample was loaded
Gene: Sax-2
MLP-PCR : Project-4, Sax-2 C-term fusion
DNA: pJW1216 (8148 bp) (25ng/ul) -0.75ul
10uM Forward primer: MG_2215_gRNA_sac2_C-2 – 0.94ul
10uM Reverse primer: MG_2203_gRNA_R_6141- 0.94ul

------------------------------------

Jose: Project 4-C-terminal sax-2 knock-in
Creating  the Cas9-sgRNA construct (pJW1219, 8168bp) containing target sequence(gRNA) using NEB Q5 Site-Directed Mutagenesis to knock-in target sequence at the C-terminal region on Sax-2 gene.
Restriction enzyme double digest was done using PDD282_GFP_Repair Template (isolate 3) using enzymes AvrII and SpeI.
We used 1% Agarose Gel with NEB 2-Log DNA ladder (0.1-1kb).


Names
SDM
Code
Primer Codes
Gene
Expected RE Digest Bands
Summary of Transformation Results(ng/μL)


Reverse primer for SDM-PCR:
Used by all of us
MG2203_sgRNA_R_6141



Jose
JAH-15
MG2210 _gRNA_sax-2_C
Sax-2
(PDD282_GFP)
6,625bp and 2,643bp(SpeI), & two 603 bp bands(AvrII)
Plasmid DNA concentrations
JAH-18-1: 572.5
JAH-18-2: 403.8
JAH-18-3: 376.3
JAH-18-4: 428.4
Leena
MLP21
MG2215_gRNA_sax-2_c-2
Sax-2
pDD286-6,digested with AvrII and NgoMIV
Expected and has observed following bands.
6654bp,2638bp,[609,603bp- seen as 1 band]
The transformation worked and the following are the plasmid DNA concentration of the single colonies, derived after DNA mini prep, measured concentration using Nanodrop:

MLP-500-1-33: 141.5 ng/ul
MLP-500-2-33:184.0 ng/ul
MLP-50-1-33: 366.7 ng/ul
MLP-50-2-33: 165.6 ng/ul
Nidhi
ND_10
MG_2209
_gRNA_sax-2_N_S
sax-2
N terminal, short isoform
ND_8
(PDD282_GFP, isolate3, C-terminal fusion Digested with AvrII and SpeI)
Bands:6,626bp, 2,643bp, and two 603 bp
ND_16a: 328.1 ng/ul
ND_16b: 203.3 ng/ul
ND_16c: 285.2 ng/ul
ND_16d: 312.8 ng/ul
Debjani
DP _13
MG2213_gRNA _unc-11_C
unc-11 C terminal knock in
DP_11
(PDD286_RFP)
C-terminal fusion digested with AvrII and NgoMIV
Bands: 6,628bp, 2,643bp, and two 603 bp
Plasmid DNA NanoDrop concentration
DP26_1:462.0 ng/μL,
DP26_2: 347.9ng/μL,     DP26_3: 319.3 ng/μL
DP26_4:  327.5 ng/μL