PROJECT 3. Repair Template Verification (ND).

PROJECTS 3 and 5. Homology Arm Amplification

Lane code	Amplification	Amplicon size	Project
ND 22_1 ND 22_2	5’ Homology arm amplification	746 bp	Project 3 Sax-2_N_S
ND 22_3 ND 22_4	3’ Homology arm amplification	741 bp
DP_315’F DP_315’R	5’ Homology arm amplification	No result	Project 5 Unc-11_C_S
DP_313’F DP_315’F	3’ Homology arm amplification	No result
AH 21_1 AH 21_2	5’ Homology arm amplification	721 bp
AH 21_3 AH 21_4	3’ Homology arm amplification	795 bp

1.5% Agarose gel was used.

Nidhi: Creating an N-terminal fusion of sax-2 gene short isoform.

a)    Created the sgRNA::CAS9 construct (pJW1219, 8168bp) containing the gRNA corresponding to sax-2 gene short isoform via SDM.

b)    RE digestion of repair template (pDD282_GFP_isolate 3, 10475bp) with AvrII and SpeI.

---------------------------

Debjani: Creating a C-terminal fusion of unc-11 gene knock in.

               Forward primer : cgactagaCTAtaatccaaaGTTTAAGAGCTATGCTGGAA

                 Reverse Primer  : CAAGACATCTCGCAATAGGA

    Purpose : For SDM to create the Cas9-sgRNA construct (pJW1219) to include the  guide RNA   (no PAM) corresponding to unc-11 knock in.

                 Restriction enzyme digestion of repair template (pDD286_RFP_Knock in ) with AvrII and NgoMIV.

---------------------------------

Leena: Ran a 1% agarose gel with 2-log DNA ladder(0.1-1kb)

Creating a C-terminal fusion for sax-2 gene, using NEB Q5 Site-Directed Mutagenesis. We are using Cas9-sgRNA construct (pJW1219-10, 8168bp) containing target sequence(gRNA) to knock-in target sequence of 20 nucleotides. Simultaneously creating a repair template by doing restriction digestion of ccdb in pDD286-6 using AvrII and NgoMIV.

Verifying the following:

1.RE digestion of repair template(pDD286-6) removing ccdb using AvrII and NgoMIV - 5ul sample was loaded

MLP-RE

DNA: pDD286-6 (10504 bp), 221.0ng/ul-  4.5ul

R.Enzymes:

AvrII,5U/ul –  2ul

NgoMIV,10U/ul- 1ul

RE digest products: 6654 bp, 2638 bp, (609 bp,603 bp – as one band)

2. PCR amplification of sgRNA::CAS9 construct (pJW1219-10, 8168bp) containing the target sequence, knock in - C-terminal fusion using SDM. - 4ul sample was loaded

Gene: Sax-2

MLP-PCR : Project-4, Sax-2 C-term fusion

DNA: pJW1216 (8148 bp) (25ng/ul) -0.75ul

10uM Forward primer: MG_2215_gRNA_sac2_C-2 – 0.94ul

10uM Reverse primer: MG_2203_gRNA_R_6141- 0.94ul

------------------------------------

Jose: Project 4-C-terminal sax-2 knock-in
Creating  the Cas9-sgRNA construct (pJW1219, 8168bp) containing target sequence(gRNA) using NEB Q5 Site-Directed Mutagenesis to knock-in target sequence at the C-terminal region on Sax-2 gene.
Restriction enzyme double digest was done using PDD282_GFP_Repair Template (isolate 3) using enzymes AvrII and SpeI.
We used 1% Agarose Gel with NEB 2-Log DNA ladder (0.1-1kb).

Names	SDM Code	Primer Codes	Gene	Expected RE Digest Bands	Summary of Transformation Results(ng/μL)
		Reverse primer for SDM-PCR: Used by all of us MG2203_sgRNA_R_6141
Jose	JAH-15	MG2210 _gRNA_sax-2_C	Sax-2	(PDD282_GFP) 6,625bp and 2,643bp(SpeI), & two 603 bp bands(AvrII)	Plasmid DNA concentrations JAH-18-1: 572.5 JAH-18-2: 403.8 JAH-18-3: 376.3 JAH-18-4: 428.4
Leena	MLP21	MG2215_gRNA_sax-2_c-2	Sax-2	pDD286-6,digested with AvrII and NgoMIV Expected and has observed following bands. 6654bp,2638bp,[609,603bp- seen as 1 band]	The transformation worked and the following are the plasmid DNA concentration of the single colonies, derived after DNA mini prep, measured concentration using Nanodrop: MLP-500-1-33: 141.5 ng/ul MLP-500-2-33:184.0 ng/ul MLP-50-1-33: 366.7 ng/ul MLP-50-2-33: 165.6 ng/ul
Nidhi	ND_10	MG_2209 _gRNA_sax-2_N_S	sax-2 N terminal, short isoform	ND_8 (PDD282_GFP, isolate3, C-terminal fusion Digested with AvrII and SpeI) Bands:6,626bp, 2,643bp, and two 603 bp	ND_16a: 328.1 ng/ul ND_16b: 203.3 ng/ul ND_16c: 285.2 ng/ul ND_16d: 312.8 ng/ul
Debjani	DP _13	MG2213_gRNA _unc-11_C	unc-11 C terminal knock in	DP_11 (PDD286_RFP) C-terminal fusion digested with AvrII and NgoMIV Bands: 6,628bp, 2,643bp, and two 603 bp	Plasmid DNA NanoDrop concentration DP26_1:462.0 ng/μL, DP26_2: 347.9ng/μL,     DP26_3: 319.3 ng/μL DP26_4:  327.5 ng/μL