Homology arm Result for Project 2 (Gel image 2 after 10 mins extra run time)
In this step of project 2 (N-terminal knock-in of unc-11 long isoform), we amplified our homology arms from C.elegans genomic DNA.
Lane 1 and 2: 5' homology arm (ISOLATE CODES?)
Lane 3 and 4: 3' homology arm (ISOLATE CODES?)
Lane 5: 1kb ladder from NEB
Lane 6 and 7: 5' homology arm (ISOLATE CODES?)
Lane 8 and 9: 3' homology arm (ISOLATE CODES?)
The predicted sizes of each arm are 699bp for 5' and 605bp for 3'. Pairs of primers used:
5' Homology- Forward primer:TGTAAAACGACGGCCAGTCGGGCAAATCCCTGCGGAAATGAGA
5' Homology- Reverse primer: TCCTCTCCCTTGGAGACCATgtcgagcagcaaggggggt
3' Homology- Forward primer: TGATCAGCGAGGAAGACTTGATGcagactatcgagaaagc
3' Homology- Reverse primer: AACAGCTATGACCATGTTATtcgagagctaatttcagcga
Comparing the sizes of the bands with 1kb ladder, the bands run from 600pb to 700bp as what expected.
This comment has been removed by the author.
ReplyDeleteIn this step of project 2 (unc-11, N terminal fusion, long isoform), we tried to build the map of homology arms selected from unc-11 gene of C.elegans that will be working in the pDD286 gene.
ReplyDeleteOn the gel:
Lane 1 and 2: 5' homology arm (TN's samples)
Lane 3 and 4: 3' homology arm (TN's samples)
Lane 5: 1kb ladder from NEB
Lane 6 and 7: 5' homology arm (RV's samples)
Lane 8 and 9: 3' homology arm (RV's sample)
The predicted sizes of each arm are 699bp for 5' and 605bp for 3'. Pairs of primers used:
5' Homology- Forward primer:TGTAAAACGACGGCCAGTCGGGCAAATCCCTGCGGAAATGAGA
5' Homology- Reverse primer: TCCTCTCCCTTGGAGACCATgtcgagcagcaaggggggt
3' Homology- Forward primer: TGATCAGCGAGGAAGACTTGATGcagactatcgagaaagc
3' Homology- Reverse primer: AACAGCTATGACCATGTTATtcgagagctaatttcagcga
Comparing the sizes of the bands with 1kb ladder, the bands run from 600pb to 700bp as what expected.
Lane 6-9 tube codes RV 21-1, RV 21-2, RV-3 and RV 21-4
ReplyDelete