Wednesday, May 11, 2016

PROJECT 2. Homology Arm Amplification

                     

                 Homology arm Result for Project 2 (Gel image 2 after 10 mins extra run time)

In this step of project 2 (N-terminal knock-in of unc-11 long isoform), we amplified our homology arms from C.elegans genomic DNA. 

Lane 1 and 2: 5' homology arm (ISOLATE CODES?)
Lane 3 and 4: 3' homology arm (ISOLATE CODES?)
Lane 5: 1kb ladder from NEB
Lane 6 and 7: 5' homology arm (ISOLATE CODES?)
Lane 8 and 9: 3' homology arm (ISOLATE CODES?)

The predicted sizes of each arm are 699bp for 5' and 605bp for 3'. Pairs of primers used:
5' Homology- Forward primer:TGTAAAACGACGGCCAGTCGGGCAAATCCCTGCGGAAATGAGA
5' Homology- Reverse primer: TCCTCTCCCTTGGAGACCATgtcgagcagcaaggggggt
3' Homology- Forward primer: TGATCAGCGAGGAAGACTTGATGcagactatcgagaaagc
3' Homology- Reverse primer: AACAGCTATGACCATGTTATtcgagagctaatttcagcga

Comparing the sizes of the bands with 1kb ladder, the bands run from 600pb to 700bp as what expected.

3 comments:

  1. This comment has been removed by the author.

    ReplyDelete
  2. In this step of project 2 (unc-11, N terminal fusion, long isoform), we tried to build the map of homology arms selected from unc-11 gene of C.elegans that will be working in the pDD286 gene.

    On the gel:

    Lane 1 and 2: 5' homology arm (TN's samples)
    Lane 3 and 4: 3' homology arm (TN's samples)
    Lane 5: 1kb ladder from NEB
    Lane 6 and 7: 5' homology arm (RV's samples)
    Lane 8 and 9: 3' homology arm (RV's sample)

    The predicted sizes of each arm are 699bp for 5' and 605bp for 3'. Pairs of primers used:
    5' Homology- Forward primer:TGTAAAACGACGGCCAGTCGGGCAAATCCCTGCGGAAATGAGA
    5' Homology- Reverse primer: TCCTCTCCCTTGGAGACCATgtcgagcagcaaggggggt
    3' Homology- Forward primer: TGATCAGCGAGGAAGACTTGATGcagactatcgagaaagc
    3' Homology- Reverse primer: AACAGCTATGACCATGTTATtcgagagctaatttcagcga

    Comparing the sizes of the bands with 1kb ladder, the bands run from 600pb to 700bp as what expected.

    ReplyDelete
  3. Lane 6-9 tube codes RV 21-1, RV 21-2, RV-3 and RV 21-4

    ReplyDelete

Note: Only a member of this blog may post a comment.